Surf Wiki
Save to docs
general/haplogroup-r

From Surf Wiki (app.surf) — the open knowledge base

Haplogroup R2

Human Y-chromosome DNA haplogroup

Human Y-chromosome DNA haplogroup

FieldValue
nameR2
mapHaplogroup R (Y-DNA).png
origin-date27,000 BP
origin-placeSouth Asia or Central Asia
ancestorHaplogroup R
descendantsR2a (M124);
R2b (FGC21706)
mutationsM479

| origin-date = 27,000 BP | origin-place = South Asia or Central Asia R2b (FGC21706)

Haplogroup R2, or R-M479, is a Y-chromosome haplogroup characterised by genetic marker M479. It is one of two primary descendants of Haplogroup R (R-M207), the other being R1 (R-M173).

R-M479, especially its downstream R2a (R-M124), has been concentrated geographically in South Asia, Central Asia and parts of the Middle East since prehistory. R2 (excluding R2a) appears to reach its highest levels among the Burusho people in North Pakistan.

R2 has much lower rates of sampling compared to its R1 counterpart with 399 branches downstream off R-M479, opposed to 46,529 for R-M173.

It has two primary branches: R2a (M124) and R2b (R-FGC21706)

Structure

  • R (M207/Page37/UTY2)
    • R1 (M173/P241/Page29)
    • R2 (M479/PF6107, L266/PF6108, L722, L726)
      • R2a (M124, F820/Page4, L381, P249)
        • R2a1 (L263)
        • R2a2 (P267/PF6109)
      • R2b (FGC21706, FGC50198, FGC50325, FGC50333, SK2163, SK2164, SK2165, SK2166)
        • R2b1 (FGC50339) Source: ISOGG 2017.

Geographical distribution

Most research has tested only for the presence of R-M479 (R2) and R-M124 (R2a) – or SNPs downstream from M124 like P249, P267, L266, PAGES00004, and L381 SNPs). Because the other primary branch, R2b (R-FGC21706) was discovered later than R2a, it has often not been tested for. Hence most results are best described as R2(xR2a).

In addition, relatively little research has been done within South Asia, which is known to have the greatest concentration of R2. (Hence the figures cited in the table right may not be indicative of true frequencies, i.e. Pakistan is the only South Asian country that has been included.)

In 2013, R2(xR2a) was found in 5 out of 19 males from the Burusho minority of North Pakistan.

R2a (R-M124)

Haplogroup R2a (R-M124) is characterised by SNPs M124, F820/Page4, L381, P249, and is mainly found in South Asia, with lower frequencies in Central Asia, Middle East and the Caucasus. R-M124 is also found in multiple Jewish populations: Iraqi Jews, Persian Jews, Mountain Jews, and Ashkenazi Jews.

R2b (R-FGC21706/ R-FGC50231)

It is found especially in the Indian subcontinent. On FTDNA the greatest frequency of R-FGC50231 testers originate from Pakistan, with 2% of testers being classified as R-FGC50231, additionally other prominent nations include, India, Afghanistan and Tajikistan.

Phylogenetic tree

Description of the SNP M479

Common Name MarkerYCC HaplogroupNucleotide changeAmplicon size (bp) reference sequencePolymorphism position from 5' endRestriction enzyme variantRefSNP IDY-positionPrimer forward 5'-3'Primer reverse 5'-3'
M479
R-M479
C to T
323
107
HphI
19294055
gatactttatcaggcttacttc
aaccaaatctctcagaatcg

Notes

References

  1. [https://isogg.org/tree/ISOGG_HapgrpR.html ISOGG, 2017, ''Y-DNA Haplogroup R and its Subclades – 2017''] (17 June 2017).
  2. (1 December 2006). "A Synthesis of Haplogroup R2".
  3. (2013). "Afghan Hindu Kush: Where Eurasian Sub-Continent Gene Flows Converge". PLOS ONE.
  4. "FamilyTreeDNA - Genetic Testing for Ancestry, Family History & Genealogy".
  5. Kevin Alan Brook, ''The Jews of Khazaria, Third Edition'', Rowman & Littlefield, 2018, p. 185.
  6. "R-FGC50227 YTree".
  7. "Welcome to FamilyTreeDNA Discover".
Info: Wikipedia Source

This article was imported from Wikipedia and is available under the Creative Commons Attribution-ShareAlike 4.0 License. Content has been adapted to SurfDoc format. Original contributors can be found on the article history page.

haplogroup-r human-y-dna-haplogroups
Want to explore this topic further?

Ask Mako anything about Haplogroup R2 — get instant answers, deeper analysis, and related topics.

Research with Mako

Free with your Surf account

Content sourced from Wikipedia, available under CC BY-SA 4.0.

This content may have been generated or modified by AI. CloudSurf Software LLC is not responsible for the accuracy, completeness, or reliability of AI-generated content. Always verify important information from primary sources.

Report