Regulation of prostaglandin synthesis and cell adhesion by a tryptophan catabolizing enzyme

Abstract

together with the effects of overexpression of IDO on the growth and morphology of cells. Overexpression of IDO in the murine macrophage cell line RAW 264.7 and the murine fibrosarcoma cell line MC57, resulted in the growth of macroscopic cell foci, with altered cell adhesion properties. The expression of IDO was also detected during adhesion of wild type, nontransfected cells in tissue culture to standard cell growth substrates. Inhibition of this expression, likewise resulted in alterations in cell adhesion. Overexpression of IDO or inhibition of endogenous IDO expression was accompanied by changes in metalloproteinase expression and also in the expression and activity of the cyclooxygenase enzymes. In the case of RAW cells, IDO effects on cell growth could be reversed by adding back prostaglandins. These results suggest that catabolism of the rarest essential amino acid may regulate processes such as cell adhesion and prostaglandin synthesis.

Background

together with the effects of overexpression of IDO on the growth and morphology of cells.

Results

Overexpression of IDO in the murine macrophage cell line RAW 264.7 and the murine fibrosarcoma cell line MC57, resulted in the growth of macroscopic cell foci, with altered cell adhesion properties. The expression of IDO was also detected during adhesion of wild type, nontransfected cells in tissue culture to standard cell growth substrates. Inhibition of this expression, likewise resulted in alterations in cell adhesion. Overexpression of IDO or inhibition of endogenous IDO expression was accompanied by changes in metalloproteinase expression and also in the expression and activity of the cyclooxygenase enzymes. In the case of RAW cells, IDO effects on cell growth could be reversed by adding back prostaglandins.

Conclusions

These results suggest that catabolism of the rarest essential amino acid may regulate processes such as cell adhesion and prostaglandin synthesis.

Background

].

].

]. As IDO is strongly expressed at the maternal-fetal interface in pregnant mice and women, we have suggested that IDO plays a role in fetal defense against the maternal immune system and could represent a novel means of immunoregulation. The apparently diverse functions and tissue distribution of IDO may have as a common theme the fact that tryptophan is the rarest essential amino acid and could be the target for cellular regulatory mechanisms. If so, tryptophan concentrations in cellular microenvironments might play a critical role in modulating various cellular processes in a way that cannot be achieved by the hepatic enzyme TDO which regulates systemic tryptophan concentrations.

], although the exact mechanism is unclear. Therefore we decided to directly test whether IDO plays a role in controlling interactions with other cells and also the surrounding extracellular environment.

Our results demonstrate that tryptophan catabolism has significant effects on cell adhesion and regulates the activity and expression of cyclooxygenases 1 and 2 (COX-1 and -2).

Constitutive overexpression of IDO alters cell adhesion

). At a certain point in focus growth, multicellular aggregates of RAW cells would break off from the focus and could be seen floating in suspension in the tissue culture medium. Wild type RAW cells or RAW cells transfected with vector alone and, to a lesser extent, clones 6 and 8 demonstrated a reduced ability to form macroscopic foci.

. (A) IDO construct used to transfect RAW cells showing X, Y and W/S boxes of MHC Class II promoter. (B) Relative copy number determination of IDO-transfected RAW cell clones. The rabbit β globin intron present in the construct was used as a probe for hybridization by slot blot. (C) RT-PCR of total RNA isolated from RAW transfectants following 15 cycles of RT-PCR, electrophoresis on 0.8% agarose, followed by Southern blotting and hybridization with an IDO specific probe. (D) Western blot of IDO-expressing RAW cell transfectants, using IDO-specific polyclonal antibody. (E) HPLC determination of tryptophan depletion from tissue culture medium by IDO-expressing RAW cells, 48 hours post-seeding into fresh medium. V; Vector-only control transfectant. Clones 6, 8, 11, 22; IDO-expressing RAW clones.

. (A) Flasks of RAW cell clones stained with trypan blue and photographed under normal light. Flasks are arranged in order of increasing IDO expression and show foci visible to the naked eye. V; Vector only control. (B) Vector-only transfected RAW cells. (C) Clone 11 IDO-expressing RAW cells. (D) Vector-only transfected MC57 cells. (E) IDO-expressing MC57 cell clone. Bar = 250 μm.

). The murine monocytic cell line P388 was also transfected and expressed IDO. It likewise exhibited a change in morphology similar to that described above and clones expressing IDO often changed from non-attached suspension cultures to adherent cultures which resembled RAW cells(not shown).

).

RAW cells were seeded into 24 well tissue culture plates coated with fibronectin and the percentage of cells adhering to the plate 45 minutes later was determined. (B) Adhesion of clone 11 and vector-only RAW cells to type I collagen-coated tissue culture dishes. Assay system was the same as for A.

IDO expression is induced during cell attachment to growth substrates

). Onset of expression coincided with the time when the majority of cells had begun to adhere to the plate.

M RA. Cultures were harvested at various time points and assayed for IDO expression by RT-PCR. (C) Effect of EGTA on expression of IDO 24 hours following seeding of P19 aggregates. P19 cells were seeded into suspension cultures in the presence of 5 mM (lane 1), 3 mM(lane 2), 1 mM (lane 3) or no EGTA (lane 4). (D) IDO antisense expression. RT-PCR products electrophoresed on 0.8% agarose. Lanes; 1&2: antisense clone C2, 3&4: antisense clone D3, 5&6: antisense clone E6, 7: molecular weight marker. Lanes marked with + or -; reverse transcriptase present or absent respectively.

]. Differentiation is dependent on an initial, 3-5 day incubation as multicellular aggregates in suspension culture, in the presence of drug, followed by a similar period growing as monolayer adherent cells in the absence of drug. Mature differentiated cells begin to appear during this subsequent growth period in the absence of drug.

M RA, which induces neuronal differentiation also induced a transient burst of IDO transcription but the period was shorter and the peak level observed was lower than that observed with DMSO.

). Therefore, IDO expression appeared to be induced by reattachment, rather than detachment from a previous substrate. Thus, IDO is thus expressed endogenously in various cell types and is induced during cell attachment to growth substrates.

Inhibition of endogenous IDO expression disrupts P19 cell adhesion

). The ability of the sense and antisense transfectants to deplete tryptophan from culture medium was determined following 48 hours in culture. IDO sense transfected P19 cells depleted 10% of available culture tryptophan (not shown) while IDO antisense transfected P19 clones which expressed high levels of antisense (clones D3 and E6) depleted essentially no tryptophan from the medium. Clone C2, which expressed low levels of IDO antisense, depleted similar levels of tryptophan to the sense control. Therefore, the burst of IDO expression, which takes place in cells during reattachment does not result in substantial tryptophan depletion from culture medium

) produced aggregates which were only loosely packed and a substantial number of cells which did not package into any form of aggregate while antisense clone D3 formed aggregates more diverse in shape than the uniformly spherical controls but less diverse than clone E6. Clone C2 produced aggregates similar to sense transfected controls (not shown).

. (A-C) P19 cells growing as a monolayer. (A) IDO-sense (B) IDO-antisense transfected P19 clone D3 (C) IDO antisense clone E6, growing as a monolayer. Bar:1 mm. (D-E); P19 cells growing as aggregates. (D) Aggregates from IDO sense-transfected P19 cells, (E) aggregates from IDO antisense-transfected P19 clone D3 grown in suspension for 30 hours in the presence of 1% DMSO. (F) Clone E6 treated as for D3. Bar: 50 mm (G) A representative field at 10x magnification was selected and the areas of 50 individual aggregates was calculated for both sense and antisense clone E6. Results are shown as the percentage of the total aggregates analyzed whose areas are within a given 0,2 sq. inch interval. (H) Percentage of IDO-sense and-antisense transfected P19 cells migrating to lower chamber of 24 well tissue culture plates18 hours following seeding. S: sense control, E6, D3, C2: antisense clones.

). In contrast, less than1% of control cells had migrated in the same period. Clones C2 and D3 produced intermediate levels of migration. When inserts were coated with Matrigel, no significant migration was seen in either antisense or sense transfectants, indicating that cell motility could be inhibited by supplying an extracellular matrix.

IDO axpression alters metalloproteinase expression

). Pharmacological inhibition of MMP activity in P19 cells using the broad spectrum, hydroxamic acid-based MMP inhibitor GM 6001 at concentrations ranging from 1-30 μM, resulted in partial reversal of the poor aggregation shown by IDO-AS expressing cells, with a maximal effect shown at 20 μM, indicating that changes in MMP expression were responsible, at least in part for altered cell adhesion.

. (A) IDO sense and antisense-transfected P19 cells were aggregated in 1% DMSO for 30 hours before total RNA was isolated and metalloproteinase gene expression assayed by RT-PCR. Lanes: 1-antisense clone E6, 2-antisense clone D3, 3-antisense clone C2, 4-sense. (B) Collagenase gene expression in IDO-expressing RAW transfectants. V: vector-only, 6,8, 11, 22: IDO expressing RAW clones.

IDO regulates prostaglandin synthesis

To understand the mechanism of IDO induced alterations in cell adhesion and MMP expression, we attempted to reverse IDO effects on cell adhesion. As previously mentioned, tryptophan is not significantly depleted in culture medium of RAW cells overexpressing IDO, suggesting that tryptophan deprivation is not the cause of the IDO effect. Consistent with this, adding back tryptophan to IDO-expressing RAW cells did not reverse the growth of macroscopic foci. As tryptophan is not the only substrate for IDO, we also investigated whether adding serotonin would overcome the effects of IDO expression. There was a similar lack of effect of this compound. This suggested that depletion or reduction of an IDO substrate was probably not responsible for the effects described here. An alternative possibility was that a biologically active downstream catabolite of IDO could be the cause. Therefore, we tested the tryptophan catabolites, picolinic acid and quinolinic acid to see if they could reproduce the effects of IDO overexpression. Picolinic acid (1-6 mM) produced morphological changes in both MC57 and RAW cells and also substantial reductions in growth rate but did not mimic the effects of IDO expression. In particular, at a concentration of 2 mM, picolinic acid induced a more flattened phenotype. At concentrations above 6 mM, picolinic acid-induced apoptosis was observed. Quinolinic acid was essentially without effect at concentrations up to 10 mM. Therefore, the exact mode of action of IDO therefore remains to be determined.

.

. (A) Analysis of prostaglandin production by vector-only transfected RAW cells () and IDO-expressing clone 11 () (B) Analysis of prostaglandin production by vector-only transfected () and clone 24 () IDO-expressing MC57 cells.

).

. (A) Expression of COX-1 and COX-2 protein by vector-only transfected (Vo) and IDO expressing clones. (B) Effect of LPS treatment on expression of COX-1 and COX-2 in IDO-expressing clones. Vector-only and IDO-expressing RAW cells were treated with 1 ng/ml LPS for 12 hours. (C) COX-2 expression in vector-only or IDO-expressing MC57 cells.

also resulted in a slight increase in focus numbers (not shown).

. (A) Vector-only transfected RAW cells were incubated with the indicated concentrations of PGs for 48 hours and stained with trypan blue. (B) Clone 11 RAW cells were incubated with the indicated concentrations of PGs for 48 hours and stained as for A.

ratio plays an important role in mediating IDO's effects on cell growth and morphology.

Discussion

. In particular, cell adhesion is altered dramatically by overexpressing IDO in cells which do not otherwise express it, or inhibiting IDO expression in cells in which it is naturally induced following cell passage. Specifically, overexpression of IDO in RAW and MC57 cells resulted in the growth of macroscopic foci and other phenotypic alterations. The cell foci were multicellular aggregates, which grew vertically as well as horizontally across the plate surface and contained significant numbers of necrotic cells within their interior, as judged by trypan blue exclusion. Conversely, in P19 cell aggregates in which IDO expression was inhibited, there was a more dispersed phenotype with cells losing the ability to interact with each other. We have recently confirmed that IDO expression in RAW cells following cell passage is likewise important for correct cell adhesion (results not shown).

may be responsible for IDO effects in this cell line.

], providing circumstantial support for the latter possibility.

].

]. Prostaglandins may provide a common link between these important biological phenomena.

Conclusions

IDO regulates adhesion of cells to normal growth substrates. In so doing it modulates the expression and activity of COX-2 and certain MMPs. RAW cells and MC57 cells overexpressing IDO grew as multicellular foci. In the case of RAW cells, this was due to elevated PGE relative to other prostaglandins. P19 cells in which endogenousIDO expression was disrupted by antisense expression, showed lower adhesiveness. Thus, tryptophan catabolism exerts control over fundamental cellular functions.

Cells

]. RAW 264.7 cells were a gift of Dr. D. Greaves (Oxford, England) and were cultured in Iscove's Modified Dulbecco's Medium supplemented with 10% fetal calf serum. MC57 cells were obtained from Dr. Dimitrios Moskiphidis, Medical College of Georgia and grown in Iscove's Modified Dulbecco's Medium.

IDO expression

], previously modified by the introduction of a Not I site in front of the Eco RI cloning site. Plasmid DNA was linearized and transfected into RAW cells by electroporation. Stably transfected lines were selected in 400 mg/ml G418 and thereafter maintained in 200 mg/ml G418. MC57 cells were also transfected by electroporation and selected in 1.2 mg/ml G418.

RT-PCR

]. Primers for amplification of other gene specific transcripts were as follows; stromelysin-1; 5' GATGACAGGGAAGCTGGA forward, 5' ACTGCGAAGATCCACTGA reverse. Stromelysin-2; 5' GATGTACCCAGTCTACAGGT 3' forward, 5' TGTCTTGTCTCATCATTACT 3' reverse. Stromelysin-3; 5' CTGCTGCTCCTGTTGCTGCT 3' forward, 5' ACCTTGGAAGAACCAAATC 3' reverse. Meltrin-α; 5' TGCATCAGTGGTCAGCCTCA 3' forward, 5' CTTTCTCTGCGGCCATTCTG 3' reverse. Meltrin-β; 5' TTCAGTTTACACATCAGAC 3' forward, 5' AGGTCACATTGCCGAACCT 3' reverse. Collagenase I; 5' GATTGTGAACTATACTCCT 3' forward, 5' CCATAGTCTGGTTAACATCA 3' reverse. Collagenase IV; 5' GTATGGAGCGACGTCACT 3' forward, 5' CGCTCCAGAGTGCTGGCA 3' reverse. GAPDH; 5' TGCAGTGGCAAAGTGGAG 3' forward 5' CCATCCACAGTCTTCTG 3' reverse.

Antisense inhibition of IDO expression

]. An antisense primer was then added and the cDNA PCR amplified for 25 cycles. Products were electrophoresed in 0.8% agarose.

Western blotting

RAW cells expressing IDO and vector only controls were harvested in cell lysis buffer (PBS, 1%NP40, 0.5% sodium deoxycholate, 0.1% SDS, 150 ng/ml PMSF, 100 ng/ml aprotinin) and 25 μg of cell protein was electrophoresed on 10% polyacrylamide gels overlayed with a 5% stacking gel. Protein was quantitated using the BCA assay (Pierce). COX-1 and COX-2 antibodies (Santa Cruz Biotechnology Inc) were used in combination with standard ECL techniques. Rabbit polyclonal IDO-specific antibody was generated against a C-terminal peptide of 42 amino acids; KPSKKKPTDGDKSEEPSNVESRGTGGTNPMTELRSVKDTTEK.

Measurement of tryptophan depletion by HPLC

Supernatants from cell cultures were extracted with HPLC grade methanol and analyzed on a Beckman Phenomenix C18(2) HPLC column and eluted with a 0-80% gradient of acetonitrile over 20 minutes. To validate retention times and for the construction of a concentration curve a standard mixture of kynurenine and tryptophan was analyzed for each assay.

Analysis of prostaglandin production

cells were harvested and resuspended in PBS and incubated at 37°C with 1.3 mCi arachidonic acid (53 mCi/mmol) for 30 mins. Following ether extraction, samples were dissolved in ethyl acetate and spotted onto thin layer chromatography plates. Plates were developed in ethyl acetate: acetic acid, 90:1, together with unlabeled standards. Individual spots were excised from the chromatogram and radioactivity determined by scintillation counting.

Cell adhesion assay

]. Briefly, cells were seeded into the wells of a 24 well plate coated with various growth substrates Following incubation at 37°C, for 45 minutes, cells unattached cells were removed by PBS washes and the remaining cells were counted.

Cell migration assay

pores/sq.cm), in a volume of 0.2 ml, in a 24 well tissue culture plate. The lower chamber contained a volume of 0.8 ml growth medium, while the final volume in the upper chamber was 0.35 ml. Chambers were incubated for 18 hours after which time the number of cells in the lower chamber was determined.

Image analysis

The size of individual P19 aggregates was determined by capturing fields of 40-50 aggregates at 10x magnification and then calculating the area of each aggregate using the NIH Image (1.62) analysis program ().

Abbreviations

CMV: cytomegalovirus

COX: cyclooxygenase

IDO: indoleamine 2,3 dioxygenase

IFN-γ interferon gamma

LPS: lipopolysaccharide

MMP: matrix metalloproteinase

NSAID: non-steroidal anti-inflammatory drug

PG: prostaglandin

TDO: tryptophan 2, 3 dioxygenase

Acknowledgements

We wish to thank Anita Wylds, Carolyn Leithner and John Nechtman for expert technical assistance and Dr. Steve Vogel for assistance with image analysis. These studies were supported by grants AA44219 and AI 42247 from the National Institutes of Health to ALM, the Departments of Medicine, Medical College of Georgia and generous support from the Carlos and Marguerite Mason Trust.